Mature sequence sbi-miR169h

Accession numberMIMAT0011334
IDsbi-miR169h
Stem-Loop sbi-MIR169h
Sequence
uagccaaggaugacuugccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).