Mature sequence sbi-miR169e

Accession numberMIMAT0011333
IDsbi-miR169e
Stem-Loop sbi-MIR169e
Sequence
uagccaaggaugacuugccgg
Get sequence
Deep sequencing reads, experiments

References

1
" Zhang L, Ware D Unpublished (2009).