Mature sequence gma-miR172e

Accession numberMIMAT0011200
IDgma-miR172e
Stem-Loop gma-MIR172e
Sequence
ggaaucuugaugaugcugcagcag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).