Mature sequence xla-miR-92a-3p

Accession numberMIMAT0011149
IDxla-miR-92a-3p
Stem-Loop xla-mir-92a-1 xla-mir-92a-2 xla-mir-92a-3 xla-mir-92a-4
Sequence
uauugcacuugucccggccugu
Get sequence
Deep sequencing reads, experiments

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).
2
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).