Mature sequence mtr-miR399p

Accession numberMIMAT0011120
IDmtr-miR399p
Stem-Loop mtr-MIR399p
Sequence
ugccaaaggagaguugcccug
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).