Mature sequence mtr-miR169k

Accession numberMIMAT0011118
IDmtr-miR169k
Stem-Loop mtr-MIR169k
Sequence
gcagccaagggugauuugccg
Get sequence
Deep sequencing reads, experiments

References