Mature sequence mtr-miR169i

Accession numberMIMAT0011110
IDmtr-miR169i
Stem-Loop mtr-MIR169i
Sequence
uugagccaaagaugacuugcc
Get sequence
Deep sequencing reads, experiments

References