Mature sequence mtr-miR171c

Accession numberMIMAT0011083
IDmtr-miR171c
Stem-Loop mtr-MIR171c
Sequence
ugauugagccgugccaauauu
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).