Mature sequence lmi-miR-8-3p

Accession numberMIMAT0010149
IDlmi-miR-8-3p
Previous IDslmi-miR-8
Stem-Loop lmi-mir-8
Sequence
uaauacugucagguaacgauguc
Get sequence
Deep sequencing reads, experiments

References

1