Mature sequence lmi-miR-8-5p

Accession numberMIMAT0010148
IDlmi-miR-8-5p
Previous IDslmi-miR-8*
Stem-Loop lmi-mir-8
Sequence
caucuuaccgggcagcauuaga
Get sequence
Deep sequencing reads, experiments

References

1