Mature sequence lmi-miR-210-3p

Accession numberMIMAT0010143
IDlmi-miR-210-3p
Previous IDslmi-miR-210
Stem-Loop lmi-mir-210
Sequence
cuugugcgugugacagcggcuau
Get sequence
Deep sequencing reads, experiments

References

1