Mature sequence lmi-miR-210-5p

Accession numberMIMAT0010142
IDlmi-miR-210-5p
Previous IDslmi-miR-210*
Stem-Loop lmi-mir-210
Sequence
agcugcuggacacugcacaaga
Get sequence
Deep sequencing reads, experiments

References

1