Mature sequence hsa-miR-2110

Accession numberMIMAT0010133
IDhsa-miR-2110
Stem-Loop hsa-mir-2110
Sequence
uuggggaaacggccgcugagug
Get sequence
Deep sequencing10267 reads, 146 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).