Mature sequence osa-miR2098-5p

Accession numberMIMAT0010060
IDosa-miR2098-5p
Stem-Loop osa-MIR2098
Sequence
ucccguggaggcagccgaug
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).