Mature sequence osa-miR1846e

Accession numberMIMAT0010042
IDosa-miR1846e
Stem-Loop osa-MIR1846e
Sequence
caacgaggaggccgggacca
Get sequence
Deep sequencing109 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).