Mature sequence mtr-miR2087-5p

Accession numberMIMAT0010036
IDmtr-miR2087-5p
Previous IDsmtr-miR2087
Stem-Loop mtr-MIR2087
Sequence
gaaguaaagaaccggcugcag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).