Mature sequence nve-miR-100-5p

Accession numberMIMAT0009605
IDnve-miR-100-5p
Previous IDsnve-miR-100
Stem-Loop nve-mir-100
Sequence
gacccguagauccgaacuugug
Get sequence
Deep sequencing73377 reads, 24 experiments

References

1
PMID:18830242 "Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals" Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP Nature. 455:1193-1197(2008).
2
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
3
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).