Mature sequence lgi-miR-2c

Accession numberMIMAT0009558
IDlgi-miR-2c
Stem-Loop lgi-mir-2c
Sequence
uaucacagccagcuuugaugagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).