Mature sequence mmu-miR-669n

Accession numberMIMAT0009427
IDmmu-miR-669n
Stem-Loop mmu-mir-669n
Sequence
auuuguguguggaugugugu
Get sequence
Deep sequencing873 reads, 76 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).