Mature sequence mmu-miR-669o-5p

Accession numberMIMAT0009421
IDmmu-miR-669o-5p
Previous IDsmmu-miR-669o
Stem-Loop mmu-mir-669o
Sequence
uaguugugugugcauguuuaugu
Get sequence
Deep sequencing123069 reads, 102 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).