Mature sequence mmu-miR-1935

Accession numberMIMAT0009399
IDmmu-miR-1935
Stem-Loop mmu-mir-1935
Sequence
gaggcagaggcuggcggaucuc
Get sequence
Deep sequencing3070 reads, 64 experiments
Predicted targets

References