Mature sequence bta-miR-92b

Accession numberMIMAT0009384
IDbta-miR-92b
Stem-Loop bta-mir-92b
Sequence
uauugcacucgucccggccucc
Get sequence
Deep sequencing115898 reads, 74 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).