Mature sequence bta-miR-655

Accession numberMIMAT0009360
IDbta-miR-655
Stem-Loop bta-mir-655
Sequence
auaauacaugguuaaccucucu
Get sequence
Deep sequencing881 reads, 63 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).