Mature sequence osa-miR159a.2

Accession numberMIMAT0009200
IDosa-miR159a.2
Stem-Loop osa-MIR159a
Sequence
uugcaugccccaggagcugca
Get sequence
Deep sequencing687 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).