Mature sequence sly-miR162

Accession numberMIMAT0009142
IDsly-miR162
Stem-Loop sly-MIR162
Sequence
ucgauaaaccucugcauccag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).