Mature sequence sly-miR156b

Accession numberMIMAT0009139
IDsly-miR156b
Stem-Loop sly-MIR156b
Sequence
uugacagaagauagagagcac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).