Mature sequence der-miR-100

Accession numberMIMAT0008488
IDder-miR-100
Stem-Loop der-mir-100
Sequence
aacccguaaauccgaacuugug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).