Mature sequence bmo-miR-184-3p

Accession numberMIMAT0007902
IDbmo-miR-184-3p
Previous IDsbmo-miR-184
Stem-Loop bmo-mir-184
Sequence
acuggacggagaacugauaagggc
Get sequence
Deep sequencing1936 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).