Accession | MIMAT0007881 |
Description | hsa-miR-1908-5p mature miRNA |
Hairpins | |
Sequence | CGGCGGGGACGGCGAUUGGUC |
Evidence |
experimental
454 [1-2], Illumina [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1900222 negative regulation of amyloid-beta clearance |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29635818 | occurs_in CL:0000576 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29635818 | has_input UniProtKB:P02649 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23142051 | has_input UniProtKB:P02649 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23142051 | has_input UniProtKB:Q8WW22 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29635818 | has_input UniProtKB:P02649 |
involved_in | GO:0010595 positive regulation of endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23142051 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23142051 | has_input UniProtKB:P02649 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23142051 | has_input UniProtKB:Q8WW22 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29635818 | has_input UniProtKB:P02649 |
involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23142051 | |
located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|