Mature sequence osa-miR1863a

Accession numberMIMAT0007813
IDosa-miR1863a
Previous IDsosa-miR1863
Stem-Loop osa-MIR1863a
Sequence
agcucugauaccauguuagauuag
Get sequence
Deep sequencing455 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).