Mature sequence gga-miR-135b

Accession numberMIMAT0007536
IDgga-miR-135b
Stem-Loop gga-mir-135b
Sequence
uauggcuuuuuauuccuuuu
Get sequence
Deep sequencing520 reads, 4 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).