Mature sequence hsa-miR-1537-3p

Accession numberMIMAT0007399
IDhsa-miR-1537-3p
Stem-Loop hsa-mir-1537
Sequence
aaaaccgucuaguuacaguugu
Get sequence
Deep sequencing569 reads, 60 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).