Mature sequence gma-miR1523a

Accession numberMIMAT0007384
IDgma-miR1523a
Previous IDsgma-miR1523
Stem-Loop gma-MIR1523a
Sequence
augggauaaaugugagcuca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2