Mature sequence gma-miR171b-3p

Accession numberMIMAT0007363
IDgma-miR171b-3p
Previous IDsgma-miR171b
Stem-Loop gma-MIR171b
Sequence
cgagccgaaucaauaucacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3