Mature sequence gma-miR162a

• Accession number: MIMAT0007353
• ID: gma-miR162a
• Previous IDs: gma-miR162
• Stem-Loop: gma-MIR162a
• Sequence: ucgauaaaccucugcaucca
• Deep sequencing: reads, experiments

References

1. PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2. PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).