Mature sequence gga-miR-454-3p

Accession numberMIMAT0007292
IDgga-miR-454-3p
Previous IDsgga-miR-454
Stem-Loop gga-mir-454
Sequence
uagugcaauauugcuuauagggu
Get sequence
Deep sequencing4982 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
2
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
3
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).