Mature sequence oan-miR-199-3p

Accession numberMIMAT0007173
IDoan-miR-199-3p
Previous IDsoan-miR-199
Stem-Loop oan-mir-199
Sequence
acaguagucugcacauugguu
Get sequence
Deep sequencing25577 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).