Mature sequence oan-miR-214-3p

Accession numberMIMAT0007171
IDoan-miR-214-3p
Previous IDsoan-miR-214
Stem-Loop oan-mir-214
Sequence
acagcaggcacagacaggcagu
Get sequence
Deep sequencing281 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).