Mature sequence oan-miR-214-5p

Accession numberMIMAT0007170
IDoan-miR-214-5p
Previous IDsoan-miR-214*
Stem-Loop oan-mir-214
Sequence
ugccugucuacacuugcugu
Get sequence
Deep sequencing150 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).