Mature sequence oan-miR-133c

Accession numberMIMAT0007150
IDoan-miR-133c
Stem-Loop oan-mir-133c
Sequence
uuugguccccuucaaccggcug
Get sequence
Deep sequencing53351 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).