Mature sequence oan-miR-100-5p

Accession numberMIMAT0007046
IDoan-miR-100-5p
Previous IDsoan-miR-100
Stem-Loop oan-mir-100
Sequence
aacccguagauccgaacuugug
Get sequence
Deep sequencing1902041 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).