Mature sequence oan-miR-133b-3p

Accession numberMIMAT0006997
IDoan-miR-133b-3p
Previous IDsoan-miR-133b
Stem-Loop oan-mir-133b
Sequence
uuugguccccuucaaccagcua
Get sequence
Deep sequencing53785 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).