Mature sequence cel-miR-58b-3p

Accession numberMIMAT0006776
IDcel-miR-58b-3p
Previous IDscel-miR-1834
Stem-Loop cel-mir-58b
Sequence
agagaucaaccauugagauccaa
Get sequence
Deep sequencing311 reads, 16 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3