Mature sequence cel-miR-1833

Accession numberMIMAT0006775
IDcel-miR-1833
Stem-Loop cel-mir-1833
Sequence
cgaggcuugcgaaauaagugugc
Get sequence
Deep sequencing146 reads, 13 experiments
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).