Mature sequence cel-miR-1830-5p

• Accession number: MIMAT0006772
• ID: cel-miR-1830-5p
• Previous IDs: cel-miR-1830
• Stem-Loop: cel-mir-1830
• Sequence: cgagguuucacguuuucuaggcc
• Deep sequencing: 129 reads, 9 experiments
• Database links:
  • RNAcentral:URS000077E547_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-1830
  • microrna.org:cel-miR-1830-5p

References

1. PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
3. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).