Mature sequence cel-miR-1830-5p

Accession numberMIMAT0006772
IDcel-miR-1830-5p
Previous IDscel-miR-1830
Stem-Loop cel-mir-1830
Sequence
cgagguuucacguuuucuaggcc
Get sequence
Deep sequencing129 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3