Mature sequence cel-miR-1824-5p

Accession numberMIMAT0006591
IDcel-miR-1824-5p
Previous IDscel-miR-1824
Stem-Loop cel-mir-1824
Sequence
uggcaguguuucucccccaacuu
Get sequence
Deep sequencing101 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
4