Mature sequence cel-miR-1823-3p

Accession numberMIMAT0006590
IDcel-miR-1823-3p
Previous IDscel-miR-1823
Stem-Loop cel-mir-1823
Sequence
uacuggaaguguuuaggaguaa
Get sequence
Deep sequencing3741 reads, 13 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2