Mature sequence cel-miR-1817

Accession numberMIMAT0006584
IDcel-miR-1817
Stem-Loop cel-mir-1817
Sequence
uagccaaugucuucucuaucaug
Get sequence
Deep sequencing232 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
3