Mature sequence ptc-miR1446c

Accession numberMIMAT0006006
IDptc-miR1446c
Stem-Loop ptc-MIR1446c
Sequence
uucugaacucucucccucaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).