Mature sequence osa-miR1439

Accession numberMIMAT0005993
IDosa-miR1439
Stem-Loop osa-MIR1439
Sequence
uuuuggaacggagugaguauu
Get sequence
Deep sequencing349 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).